Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: WMC1E8

[Submit comment/correction]

Locus	WMC1E8
Type	Microsatellite
Chromosome	1H
Map	Barley, B73xCPI-1H 127 [ Show all 16 ]
	[ Show Nearby Loci ]
Map Data	Barley, B73xCPI [ Show all 16 ]
Species	Hordeum spontaneum Hordeum vulgare
Probe	WMC1E8
Reference	[ Hide all but 1 of 6 ] Szucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remark	Number of populations contributing to the placement of WMC1E8 in the Barley, Consensus 2006 DArT maps = 1 [ Show all 8 ]
Probe	WMC1E8
Locus	WMC1E8
Reference	Hearnden PR et al. (2007) A genetic map of 1,000 SSR and DArT markers in a wide barley cross. Theoretical and Applied Genetics 115:383-391. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Ramsay L et al. (2000) A simple sequence repeat-based linkage map of barley Genetics 156:1997-2005.
Remarks	Insert contains repeat (AC)24 Quality = 2: Single product, relatively strong stutter bands Diversity Index (DI) = 0.43
Type	PCR SSR
PCR primers	5' TCATTCGTTGCAGATACACCAC 3' 5' TCAATGCCCTTGTTTCTGACCT 3' TCATTCGTTGCAGATACACCAC TCAATGCCCTTGTTTCTGACCT
SSR size	197
Amplification Conditions	1 cycle of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 30 cycles of 1 min @ 94C, 1 min @ 55C, 1 min @ 72C, 1 cycle of 5 mins @ 72C.