Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xbarc102

[Submit comment/correction]

Locus	Xbarc102
Type	Microsatellite
Chromosome	3B
Map	Wheat, UC1110 x PI610750 3B 10.5 Wheat-Composite2004-3B 30
	[ Show Nearby Loci ]
Map Data	Wheat, Composite, 2004 Wheat, UC1110 x PI610750
Probe	BARC102
Reference	Lowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
Possible Orthologs	Xbarc102-3B [ Show all 11 ]
Probe for Locus	BARC102
Locus	[ Hide all but 1 of 12 ] Xbarc102.2 Xbarc102.1 Xbarc102-3B Xbarc102 barc102 barc102a barc102a-3B barc102b barc102b-3B barc102-3B.1 barc102-3B.2 barc102-3B.3
General Remarks	Contains motif : (TTA)20 BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type	PCR SSR
PCR primers	5' GGAGAGGACCTGCTAAAATCGAAGACA 3' 5' GCGTTTACGGATCAGTGTTGGAGA 3'
Amplification Conditions	Annealing temperature = 52
Sequence	BV211585
Source Species	Triticum aestivum