Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xbarc128-1B

[Submit comment/correction]

Locus	Xbarc128-1B
Type	Microsatellite
Chromosome	1B
Map	Ta-SSR-2004-1B 19.5 USG3209/Jaypee-1B 0
	[ Show Nearby Loci ]
Map Data	Wheat, Consensus SSR, 2004 Wheat, USG3209 x Jaypee
Probe	BARC128
Reference	Somers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs	Xbarc128 [ Show all 28 ]
Probe for Locus	BARC128
Locus	[ Hide all but 1 of 29 ] Xbarc128a-2B Xbarc128b-7D Xbarc128-2B XBarc128b XBarc128a Xbarc128-5B Xbarc128-7D Xbarc128-1B Xbarc128 barc128a barc128 barc128-1B barc128-2B barc128-7D barc128a-1B barc128a-2B barc128a-5B barc128b barc128b-1B barc128b-5B barc128c barc128c-5B Xbarc128-3D barc128-1B.1 barc128-1B.2 barc128-1B.3 barc128-2B.1 barc128-2B.2 barc128-5B.1
General Remarks	BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type	PCR SSR
PCR primers	5' GCGGGTAGCATTTATGTTGA 3' 5' CAAACCAGGCAAGAGTCTGA 3'
Amplification Conditions	Annealing temperature = 52
Sequence	BV211430
Source Species	Triticum aestivum