Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xbarc147-3B

[Submit comment/correction]

Locus	Xbarc147-3B
Type	Microsatellite
Chromosome	3B
Map	[ Hide all but 1 of 7 ] Chinese_Spring_Deletion_SSR_3B -0.89 Conan/Reeder-3B 14.7946 CS/SQ1-3B 10.6 Kofa/UC1113-3B 7.3 Ta-SSR-2004-3B 7.2 Ta-Synthetic/Opata-BARC-3B 16.1 Wheat, UC1110 x PI610750 3B 6.3
	[ Show Nearby Loci ]
QTL with Locus Marker	QFhs.ndsu-3B
Breakpoint Interval	3BS8-0.78-1.00
Map Data	Durum wheat, Kofa x UC1113 [ Show all 7 ]
Probe	BARC147
Reference	Lowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157. Somers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs	barc147 [ Show all 8 ]
Probe for Locus	BARC147
Locus	Xbarc147-3B [ Show all 9 ]
General Remarks	Contains motif : CA)14 BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type	PCR SSR
PCR primers	5' GCGCCATTTATTCATGTTCCTCAT 3' 5' CCGCTTCACATGCAATCCGTTGAT 3'
Amplification Conditions	Annealing temperature = 52
Sequence	BV211628
Source Species	Triticum aestivum