Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xbarc165

[Submit comment/correction]

Locus	Xbarc165
Type	Microsatellite
Chromosome	5A
Map	Wheat, UC1110 x PI610750 5A 55.6 Wheat-Composite2004-5A 35
	[ Show Nearby Loci ]
QTL with Locus Marker	QYr.osu-5A
Map Data	Wheat, Composite, 2004 Wheat, UC1110 x PI610750
Probe	BARC165
Reference	Lowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
Possible Orthologs	Xbarc165-5A [ Show all 13 ]
Probe for Locus	BARC165
Locus	[ Hide all but 1 of 14 ] Xbarc165-5A Xbarc165 Xbarc165-6A barc165 barc165a barc165a-5A barc165a-7A barc165b barc165b-5A barc165-5A.1 barc165-5A.2 barc165-5A.3 barc165-7A barc165-5A
General Remarks	Contains motif : (ATT)19 BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type	PCR SSR
PCR primers	5' GCGTAGAGCGGCTGTTAGTGTCAAATTA 3' 5' GCGTTATCTCAAGTTTTGTAGCAGA 3'
Amplification Conditions	Annealing temperature = 50
Sequence	BV211523
Source Species	Triticum aestivum