Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xbarc186

[Submit comment/correction]

Locus	Xbarc186
Type	Microsatellite
Chromosome	5A
Map	Wheat, UC1110 x PI610750 5A 40.7 Wheat-Composite2004-5A 16
	[ Show Nearby Loci ]
Map Data	Wheat, Composite, 2004 Wheat, UC1110 x PI610750
Probe	BARC186
Reference	Lowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
Possible Orthologs	Xbarc186-5A [ Show all 10 ]
Probe for Locus	BARC186
Locus	[ Hide all but 1 of 11 ] Xbarc186-5A Xbarc186 barc186a barc186 barc186-5A barc186a-5A barc186-7A barc186b barc186b-5A barc186-5A.1 barc186-5A.2
General Remarks	Contains motif : (CT)15+4 BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type	PCR SSR
PCR primers	5' GGAGTGTCGAGATGATGTGGAAAC 3' 5' CGCAGACGTCAGCAGCTCGAGAGG 3'
Amplification Conditions	Annealing temperature = 58
Sequence	BV211828
Source Species	Triticum aestivum