Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xbarc229-1D

[Submit comment/correction]

Locus	Xbarc229-1D
Type	Microsatellite
Chromosome	1D
Map	Conan/Reeder-1D 28.6904 Ta-SSR-2004-1D 54.3 Wheat, UC1110 x PI610750 1D 17.3
	[ Show Nearby Loci ]
Map Data	Wheat, Conan x Reeder Wheat, Consensus SSR, 2004 Wheat, UC1110 x PI610750
Probe	BARC229
Reference	Lowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157. Somers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs	[ Hide all but 1 of 12 ] barc229 Xbarc229 Xbarc229-1D.1 Xbarc229-1D.2 Xbarc229-3B Xbarc229.1 Xbarc229.2 barc229-1D barc229-3B barc229-1 barc229.1 barc229-2
Probe for Locus	BARC229
Locus	Xbarc229-1D [ Show all 13 ]
General Remarks	Contains motif : (CT)20 BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type	PCR SSR
PCR primers	5' GGCCGCTGGGGATTGCTATGAT 3' 5' TCGGGATAAGGCAGACCACAT 3'
Amplification Conditions	Annealing temperature = 58
Sequence	BV211471
Source Species	Triticum aestivum