Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xbarc32-7B

[Submit comment/correction]

Locus	Xbarc32-7B
Type	Microsatellite
Chromosome	7B
Map	AUS14010xYallaroi-7BL 0 Chinese_Spring_Deletion_SSR_7B 0.5 CranbrookxHalberd-7BL 0 CS/SQ1-7B 199.1 Ta-SSR-2004-7B 142
	[ Show Nearby Loci ]
QTL with Locus Marker	QYld.saq-7B
Breakpoint Interval	C-7BL-0.00-1.00*
Map Data	Wheat, 2008, B Tolerance Wheat, Chinese Spring x SQ1 Wheat, Consensus SSR, 2004 Wheat, Physical, SSR
Probe	BARC32
Reference	Somers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs	Xbarc32 [ Show all 15 ]
Probe for Locus	BARC32
Locus	[ Hide all but 1 of 17 ] Xbarc32-7B Xbarc32 Xbarc32-5B Yr59 barc32 barc32b barc32a barc32a-7B barc32b-7B barc32c barc32c-7B barc32-5B barc32-7B.1 barc32-7B.2 barc32-7B.3 barc32-7B.4 barc32-7B
Reference	Ren RS et al. (2012) Characterization and molecular mappingof Yr52 for high-temperature adult-plant resistance to stripe rust in spring wheat germplasm PI 183527 Theoretical and Applied Genetics 125:847-857. MAS Wheat. Bringing Genomics to the Wheat Fields. Disease Resistance. Stripe Rust Resistance. Yr59 MAS Wheat. Marker Assisted Selection in Wheat.
General Remarks	Contains motif : (TAA)10 BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type	PCR SSR
PCR primers	5' GCGTGAATCCGGAAACCCAATCTGTG 3' 5' TGGAGAACCTTCGCATTGTGTCATTA 3'
Amplification Conditions	Annealing temperature = 52
Sequence	BV211664
Source Gene	Yr59 (Triticum)
Source Species	Triticum aestivum