Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xbarc74

[Submit comment/correction]

Locus	Xbarc74
Type	Microsatellite
Chromosome	5B
Map	Wheat, Avalon x Cadenza 5B1 56.1 Wheat, UC1110 x PI610750 5B 22.9 Wheat-Composite2004-5B 52 Wheat_Yr79_2018-5BS 49.4
	[ Show Nearby Loci ]
Map Data	Wheat, Avalon x Cadenza Wheat, Composite, 2004 Wheat, UC1110 x PI610750 Wheat_Yr79_2018
Probe	BARC74
Reference	Lowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
Possible Orthologs	Xbarc74-5B barc74-5B barc74
Probe for Locus	BARC74
Locus	[ Hide all but 1 of 6 ] Xbarc74-5B Ne1 Xbarc74 Stb1 barc74-5B barc74
General Remarks	Contains motif : (GA)13(GATA)7(GA)9 BARC primer pairs are developed by P. Cregan, Q. Song and associates at the USDA-ARS Beltsville Agriculture Research Station. Meiotic map information was developed by J.R. Shi, R. Ward and associates at Michigan State University. Deletion map information was developed by B.Gill, S. Singh and associates at Kansas State University. Funding for this research is provided by USDA-ARS in conjunction with the U.S. Wheat and Barley Scab Initiative.
Type	PCR SSR
PCR primers	5' GCGCTTGCCCCTTCAGGCGAG 3' 5' CGCGGGAGAACCACCAGTGACAGAGC 3'
Amplification Conditions	Annealing temperature = 60
Sequence	BV211851
Source Species	Triticum aestivum