Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xcfa2040

[Submit comment/correction]

Locus	Xcfa2040
Type	Microsatellite
Chromosome	7B
Chromosome Arm	7BL
Map	Svevo/Ciccio-7A 164.8 [ Show all 9 ]
	[ Show Nearby Loci ]
Breakpoint Interval	7AL18-0.90-1.00
Map Data	Durum wheat, Svevo x Ciccio T. turgidum, Langdon x G18-16 Wheat, Avalon x Cadenza Wheat, Nanda2419 x Wangshuibai Wheat, UC1110 x PI610750
Probe	CFA2040
Reference	Lowe I et al. (2011) Mapping and validation of QTL which confer partial resistance to broadly virulent post-2000 North American races of stripe rust in hexaploid wheat Theoretical and Applied Genetics 123:143-157.
Possible Orthologs	Xcfa2040-1D [ Show all 23 ]
Probe for Locus	CFA2040
Locus	[ Hide all but 1 of 25 ] Xcfa2040 Xcfa2040-7A Xcfa2040-7D Xcfa2040-1D Xcfa2040-2D Xcfa2040-7B Xcfa2040b Sr43 cfa2040 cfa2040-7A cfa2040a cfa2040a-7B cfa2040b cfa2040b-7B cfa2040_1 cfa2040_2 cfa2040_3 cfa2040-7A.1 cfa2040-7A.2 cfa2040-7D.1 cfa2040-7D.2 cfa2040-7B.1 cfa2040-7B.2 cfa2040-7B.3 cfa2040-7B
Reference	Sourdille P et al. (2001) Improvement of the genetic maps of wheat using new microsatellite markers Plant & Animal Genome IX Abstracts 167.
General Remarks	Quality Score = B Quality scores reflect the quality of amplification (from A very good quality to D multiple banding pattern : A and B can be used on capillary systems) Amplifies motif: (CA)16 Regularity of motif is perfect
Type	PCR SSR
PCR primers	Forward 5' TCAAATGATTTCAGGTAACCACTA 3' Reverse 5' TTCCTGATCCCACCAAACAT 3'
SSR size	286
Amplification Conditions	5 minutes at 94 degrees; 30 cycles (94 degrees for 30 seconds; 60 degrees for 30 seconds; 72 degrees for 30 seconds); 10 minutes at 72 degrees
Linkage Group	7A/7D
Source Species	Triticum urartu