Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xcmwg652-6A

[Submit comment/correction]

Locus	Xcmwg652-6A
Type	RFLP
Chromosome	6A
Chromosome Arm	6AS
Map	Ta-Synthetic/Opata-6A -63.5 Ta-Synthetic/Opata-BARC-6A 18.8 Ta-Synthetic/Opata-DR-6A -54.6 Tturgidum-Du-6A -36.3
	[ Show Nearby Loci ]
Map Data	T. turgidum, durum x dicoccoides Wheat, Synthetic x Opata  [ GBrowser ] Wheat, Synthetic x Opata, BARC Wheat, Synthetic x Opata, DR Genes
Probe	cMWG652
Possible Orthologs	cMWG652 [ Show all 14 ]
Probe for Locus	cMWG652
Locus	[ Hide all but 1 of 19 ] Xcmwg652-6 Xcmwg652-6A Xcmwg652-6B cMWG652 cMWG652a Xcmwg652 HI009D8 HD032G15 HD084J21 cMWG652B MWG652 Xcmwg652-4R Xcmwg652a-4R Xcmwg652c-6R cMWG652b-4H cMWG652a-6H cmwg652-6A cMWG652-4R cmwg652
Reference	Abu Qamar M et al. (2008) A region of barley chromosome 6H harbors multiple major genes associated with net type net blotch resistance. Theoretical and Applied Genetics 117:1261-1270. Kunzel G et al. (2000) Cytologically integrated physical restriction fragment length polymorphism maps for the barley genome based on translocation breakpoints Genetics 154:397-412. Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
General Remarks	Restriction enzyme informative in CAP analysis is HaeIII
Type	cDNA STS
STS primers	5' GAGCTGCTCGTTCTCGTTGA 5' CACACCTTCTTCTTCCTCTT
STS size	417
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234405 AJ234404 CMWG652-5 CMWG652-3
Linkage Group	6H 6
DNA Library	cMWG
Source Species	Hordeum vulgare
Source Tissue	Leaf
Insert Size	1