Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xgwm10-7A

[Submit comment/correction]

Locus	Xgwm10-7A
Type	Microsatellite
Chromosome	7A
Map	Ta-SSR-2004-7A 76.6
	[ Show Nearby Loci ]
Map Data	Wheat, Consensus SSR, 2004
Probe	WMS10
Reference	Somers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114.
Possible Orthologs	[ Hide all but 1 of 8 ] Xgwm10 Xgwm10-2A Xgwm10-2B Xgwm10-3A gwm10-3A gwm10 gwm10-2A gwm10-7A
Probe for Locus	WMS10
Locus	Xgwm10-2A [ Show all 9 ]
Reference	Roder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023. Roeder MS et al. (1995) Abundance, variability and chromosomal location of microsatellites in wheat. Molecular and General Genetics 246:327-333.
General Remarks	Insert contains repeat (AT)5(GT)15 PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER. Repeat type (AT)x5(GT)x15. Product size 166 bp in Chinese Spring.
Type	PCR SSR
PCR primers	5' CGCACCATCTGTATCATTCTG 3' 5' TGGTCGTACCAAAGTATACGG 3'
Amplification Conditions	3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 50 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism	WMS10
Source Species	Triticum aestivum
Source Germplasm	Chinese Spring