Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xgwm247-3B

[Submit comment/correction]

Locus	Xgwm247-3B
Type	Microsatellite
Chromosome	3B
Chromosome Arm	3BL
Map	[ Hide all but 1 of 6 ] Kofa/UC1113-3B 180 Ta-SSR-2004-3B 141.5 Ta-Synthetic/Opata-SSR-3B 253.2 Ta-Synthetic/Opata-update-3B 393.1 Tturgidum-JKxC-3B 319.3 Tturgidum-JKxC2-3B 328.6
	[ Show Nearby Loci ]
QTL with Locus Marker	QSf.spa-3B Qsst.msub-3BL
Map Data	Durum wheat, Kofa x UC1113 [ Show all 6 ]
Probe	WMS247
Reference	Somers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114. Roder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
Data Source	Roeder, Marion S. 98.09.15
Remark	In Map Ta-Synthetic/Opata-SSR-3B, the interval most likely to contain locus is between Xtam63 and Xmwg11
Possible Orthologs	Xgwm247 [ Show all 7 ]
Probe for Locus	WMS247
Locus	Xgwm247 [ Show all 8 ]
Reference	Fu YB et al. (2007) Microsatellite variation in Avena sterilis oat germplasm Theoretical and Applied Genetics 114:1029-1038. Roder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023.
General Remarks	Insert contains repeat (GA)24 PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER. In 369 Avena sterilis accessions there were 4 alleles of size 39-60 bp, PIC = 0.04.
Type	Genomic PCR SSR
PCR primers	5' GCAATCTTTTTTCTGACCACG 3' 5' ATGTGCATGTCGGACGC 3'
Amplification Conditions	3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 55 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism	WMS247
Source Species	Triticum aestivum
Source Germplasm	Chinese Spring