Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xgwm44-7D

[Submit comment/correction]

Locus	Xgwm44-7D
Type	Microsatellite
Chromosome	7D
Chromosome Arm	7DS
Map	Chinese_Spring_Deletion_SSR_7D -0.805 [ Show all 11 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QLtn.sfr-7D
Breakpoint Interval	7DS4-0.61-1.00
Map Data	[ Hide all but 1 of 11 ] Wheat, 2002, coleoptile color Wheat, Arina x Forno Wheat, Conan x Reeder Wheat, Consensus SSR, 2004 Wheat, Forno x Oberkulmer Wheat, Louise x Penawawa Wheat, Physical, SSR Wheat, Synthetic x Opata, BARC Wheat, Synthetic x Opata, GPW Wheat, Synthetic x Opata, SSR Wheat, Synthetic x Opata, SSR 2
Species	Triticum aestivum
Probe	WMS44
Reference	Somers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114. Paillard S et al. (2003) An integrative genetic linkage map of winter wheat (Triticum aestivum L.) Theoretical and Applied Genetics 107:1235-1242. Roder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023. Roeder MS et al. (1995) Abundance, variability and chromosomal location of microsatellites in wheat. Molecular and General Genetics 246:327-333.
Data Source	Roeder, Marion S. 98.09.15
Possible Orthologs	Xgwm44 Xgwm44-4A gwm44 gwm44-4A
Probe for Locus	WMS44
Locus	Xgwm44-7D [ Show all 6 ]
Reference	Roder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023. Roeder MS et al. (1995) Abundance, variability and chromosomal location of microsatellites in wheat. Molecular and General Genetics 246:327-333.
General Remarks	Insert contains repeat (GA)28 PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER. Repeat type (GA)x28. Product size 182 bp in Chinese Spring.
Type	PCR SSR
PCR primers	5' GTTGAGCTTTTCAGTTCGGC 3' 5' ACTGGCATCCACTGAGCTG 3'
Amplification Conditions	3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism	WMS44
Source Species	Triticum aestivum
Source Germplasm	Chinese Spring