Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xgwm47-2B

[Submit comment/correction]

Locus	Xgwm47-2B
Type	Microsatellite
Chromosome	2B
Chromosome Arm	2BL
Map	Chinese_Spring_Deletion_SSR_2B 0.18 [ Show all 8 ]
	[ Show Nearby Loci ]
Breakpoint Interval	C-2BL2-0.36
Map Data	[ Hide all but 1 of 8 ] T. turgidum, Messapia x dicoccoides, SSR Wheat, Consensus SSR, 2004 Wheat, P91193D1 x P92201D5 Wheat, Physical, SSR Wheat, Synthetic x Opata, BARC Wheat, Synthetic x Opata, GPW Wheat, Synthetic x Opata, SSR Wheat, USG3209 x Jaypee
Probe	WMS47
Reference	Somers DJ et al. (2004) A high-density wheat microsatellite consensus map for bread wheat (Triticum aestivum L.) Theoretical and Applied Genetics 109:1105-1114. Roder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023. Roeder MS et al. (1995) Abundance, variability and chromosomal location of microsatellites in wheat. Molecular and General Genetics 246:327-333.
Data Source	Roeder, Marion S. 98.09.15
Remark	In Map Ta-Synthetic/Opata-SSR-2B, the intervals most likely to contain locus are Xbcd307 - Xfba62.2 or Xfba62.2 - Xbcd1095
Possible Orthologs	gwm47 [ Show all 14 ]
Probe for Locus	WMS47
Locus	Xgwm47-2A.2 [ Show all 16 ]
Reference	Roder MS et al. (1998) A microsatellite map of wheat Genetics 149:2007-2023. Roeder MS et al. (1995) Abundance, variability and chromosomal location of microsatellites in wheat. Molecular and General Genetics 246:327-333.
General Remarks	Insert contains repeat (CT)7TT(CT)16 PRIMER SEQUENCE IS AVAILABLE FOR PUBLIC RESEARCH ONLY. REQUESTS FOR COMMERCIAL USE SHOULD BE DIRECTED TO M. ROEDER. Repeats type (CT)x7TT(CT)x16. Product size 166 bp in Chinese Spring.
Type	PCR SSR
PCR primers	5' TTGCTACCATGCATGACCAT 3' 5' TTCACCTCGATTGAGGTCCT 3'
Amplification Conditions	3 min at 94 deg C; 45 cycles with 1 min at 94 deg C, 1 min at 60 deg C, and 2 min at 72 deg C; and a final extension step of 10 min at 72 deg C
Polymorphism	WMS47
Source Species	Triticum aestivum
Source Germplasm	Chinese Spring