Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: XksuD14

[Submit comment/correction]

Locus	XksuD14
Type	RFLP
Chromosome	1A 1D 1R
Chromosome Arm	1AS 1BS 1DS 1RS
Map	1AS, T.m. G1777 x G2528 -44.9 Secale-PxP-update-1R 3.1 Ta-Physical-Gill-1ABD -86 Ta-Physical-Gill-1D -2.59 Tm-Dubcovsky-1A -45.6
	[ Show Nearby Loci ]
Breakpoint Interval	0/1DS-5 1S-0.81-0.90
Map Data	1AS, T.m. G1777 x G2528 Rye, P87 x P105, update T. monococcum, G1777 x G2528 Wheat, Physical
Species	Triticum aestivum
Probe	pTtksuD14
Reference	Boyko EV et al. (1999) A high-density genetic linkage map of Aegilops tauschii, the D-genome progenitor of bread wheat. Theoretical and Applied Genetics 99:16-26.
Possible Orthologs	D014 [ Show all 26 ]
Probe for Locus	pTtksuD14
Locus	[ Hide all but 1 of 28 ] ksuD14F ksuD14A ksuD14B ksuD14E Lr21 XksuD14-1 ksuD14 XksuD14-1A XksuD14-1B XksuD14-1D XksuD14-1A.1 XksuD14-1A.2 XksuD14-1D.1 XksuD14-1D.2 XksuD14-1D.3 XksuD14 Xksu.DGD14A Xksu.DGD14B D014 ksuD14C XksuD14A XksuD14B XksuD14.2 XksuD14.3 KSUD14 ksuD14-1A ksuD14-1D ksuD14.2
Type	Genomic STS
PCR primers	R:CCAAAGAGCATCCATGGTGT L:CGCTTTTACCGAGATTGGTC
Specificity	Primer specificity verified, maps on chromosome 1BS.
Polymorphism	KSUD14 EcoRV
Linkage Group	1D
Insert Enzyme	PstI
Source Species	Triticum tauschii
Insert Size	1.6