Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: XksuD9

[Submit comment/correction]

Locus	XksuD9
Type	RFLP
Chromosome	7D 7R
Chromosome Arm	7RL
Map	Rye-2009-Consensus-7R 35.4 Secale-Devos-7R 0.4 Secale-DxR-RAPD-7R 71.8
	[ Show Nearby Loci ]
Map Data	Rye, Ds2 x RxL10 Rye, Ds2 x RxL10, RAPD Rye_2009_consensus
Probe	pTtksuD9
Possible Orthologs	[ Hide all but 1 of 9 ] D009 XksuD9-4A XksuD9-7A XksuD9-7B XksuD9-7D XksuD9.1 XksuD9.2 XksuD9a XksuD9b
Probe for Locus	pTtksuD9
Locus	XksuD9-4A [ Show all 13 ]
Reference	Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type	Genomic STS
PCR primers	R:GGTGACGACCCGAGCGTTGAT L:CACCAGATATTGCTTGCCTCC
Polymorphism	KSUD9 HindIII KSUD9 EcoRI KSUD9 EcoRV KSUD9 DraI KSUD9 XbaI
Insert Enzyme	PstI
Source Species	Triticum aestivum Triticum tauschii