Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: XksuD9-4A

[Submit comment/correction]

Locus	XksuD9-4A
Type	RFLP
Chromosome	4A
Chromosome Arm	4AL
Map	[ Hide all but 1 of 6 ] Ta-Gale-4A 80.4 Ta-Synthetic/Opata-4A 81.9 Ta-Synthetic/Opata-BARC-4A 64.7 Ta-Synthetic/Opata-DR-4A 86 Ta-Synthetic/Opata-GPW-4A 108.8 Ta-Synthetic/Opata-SSR-4A 87.1
	[ Show Nearby Loci ]
Map Data	Wheat, Gale [ Show all 6 ]
Probe	pTtksuD9
Image	KSUD9 SO autoradiogram
Possible Orthologs	D009 [ Show all 9 ]
Probe for Locus	pTtksuD9
Locus	XksuD9-4A [ Show all 13 ]
Reference	Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type	Genomic STS
PCR primers	R:GGTGACGACCCGAGCGTTGAT L:CACCAGATATTGCTTGCCTCC
Polymorphism	KSUD9 HindIII KSUD9 EcoRI KSUD9 EcoRV KSUD9 DraI KSUD9 XbaI
Insert Enzyme	PstI
Source Species	Triticum aestivum Triticum tauschii