Query (optional) in Class All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data GrainGenes Marker Report: XksuE18-1B LocusXksuE18-1B TypeRFLP Chromosome1B Chromosome Arm1BS MapKofa/UC1113-1B19.3Ta-Synthetic/Opata-1B25.1Ta-Synthetic/Opata-BARC-1B21Ta-Synthetic/Opata-GPW-1B22.9Ta-Synthetic/Opata-SSR-1B22.6 [ Show Nearby Loci ] Map DataDurum wheat, Kofa x UC1113Wheat, Synthetic x Opata [ GBrowser ]Wheat, Synthetic x Opata, BARCWheat, Synthetic x Opata, GPWWheat, Synthetic x Opata, SSR ProbepTtksuE18 ImageKSUE18 HindIII SO autoradiogram Possible OrthologsDGE18 [ Show all 25 ] Probe for LocuspTtksuE18 Locus[ Hide all but 1 of 27 ]XksuE18-6BXksuE18-1ksuE18DGE18XksuE18-7Bksue18aksue18bXksuE18-1AXksuE18-1DXksuE18-1BXksuE18-7B.1XksuE18-7B.2XksuE18Xksu.DGE18E018XksuE18-7AXksuE18aXksuE18.3XksuE18.1ksuE18cksuE18(A)ksuE18(B)ksuE18-1AksuE18-1BksuE18-7BKSUE18AKSUE18B Reference Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374. TypeGenomicSTS PCR primersR:TGAGCCGGTTGCTGTTCGTCL:AAGCACCGACATGGTCACCC Amplification ConditionsAnneal at 45oC PolymorphismKSUE18 DraIKSUE18 HindIII Linkage Group1D Insert EnzymePstI Source SpeciesTriticum tauschii Source Tissueleaf Insert Size1.5