Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: XksuE18-7B

[Submit comment/correction]

Locus	XksuE18-7B
Type	RFLP
Chromosome	7B
Chromosome Arm	7BL
Map	Ta-Synthetic/Opata-7B 118.1 [ Show all 6 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 6 ] Wheat, Synthetic x Opata  [ GBrowser ] Wheat, Synthetic x Opata, BARC Wheat, Synthetic x Opata, DR Genes Wheat, Synthetic x Opata, gbx RFLP Wheat, Synthetic x Opata, SSR Wheat, Synthetic x Opata, SSR 2
Probe	pTtksuE18
Image	KSUE18 HindIII SO autoradiogram
Possible Orthologs	DGE18 [ Show all 25 ]
Probe for Locus	pTtksuE18
Locus	XksuE18-6B [ Show all 27 ]
Reference	Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type	Genomic STS
PCR primers	R:TGAGCCGGTTGCTGTTCGTC L:AAGCACCGACATGGTCACCC
Amplification Conditions	Anneal at 45oC
Polymorphism	KSUE18 DraI KSUE18 HindIII
Linkage Group	1D
Insert Enzyme	PstI
Source Species	Triticum tauschii
Source Tissue	leaf
Insert Size	1.5