Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: XksuF2-7D.4

[Submit comment/correction]

Locus	XksuF2-7D.4
Type	RFLP
Synonym	Other name XksuF2(D)-7D Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374. XksuF2-7D(4) McIntosh RA et al. (1995) Catalogue of gene symbols for wheat. Proceedings of the 8th International Wheat Genetics Symposium 1333-1500.
Chromosome	7D
Species	Triticum aestivum
Probe	pTtksuF2
Reference	Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Possible Orthologs	F002a [ Show all 16 ]
Probe for Locus	pTtksuF2
Locus	[ Hide all but 1 of 22 ] ksuF2A XksuF2-7B XksuF2-7D.1 XksuF2-7D.2 XksuF2-7D.3 XksuF2-7D.4 XksuF2-7D.5 XksuF2 Xksu.DGF2 RI041N4 HI049H16 HD049H16 D1.1_ctg10001 D1.1_ctg753 F002a F002b F002d F002e ksuF2B XksuF2-5A DGF2 ksuF2
Type	Genomic STS
PCR primers	R:TTCGCCATTAGAGCAACCTG L:GGAGATGGATTCCCTTGTCC
Polymorphism	KSUF2 DraI
Linkage Group	2D / 7D (5)
Insert Enzyme	PstI
Source Species	Triticum aestivum Triticum tauschii
Insert Size	0.3