Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: XksuF37-6A

[Submit comment/correction]

Locus	XksuF37-6A
Type	RFLP
Chromosome	6A
Chromosome Arm	6AL
Map	Tturgidum-Du-6A 46
	[ Show Nearby Loci ]
Map Data	T. turgidum, durum x dicoccoides
Species	Triticum turgidum
Probe	pTtksuF37 Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Reference	Chen Z et al. (1994) Use of recombinant substitution lines in the construction of RFLP-based genetic maps of chromosomes 6A and 6B of tetraploid wheat (Triticum turgidum L.). Theoretical and Applied Genetics 89:703-712.
Remark	In map Tturgidum-Du-6A, this locus was mapped within the indicated interval, based on data from a different RSL population.
Possible Orthologs	F037 ksuF37 XksuF37 XksuF37-6B XksuF37-6R
Probe for Locus	pTtksuF37
Locus	[ Hide all but 1 of 9 ] XksuF37-6A XksuF37-6B RI021P20 RI047N17 HI010F22 F037 XksuF37 ksuF37 XksuF37-6R
Type	Genomic STS
PCR primers	R:CACAAAGACAAAGAACTAAT L:TTCAGATTTTCACAGATTTA
Linkage Group	6D
Insert Enzyme	PstI
Source Species	Triticum aestivum Triticum tauschii
Insert Size	0.9