Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: XksuG48

[Submit comment/correction]

Locus	XksuG48
Type	RFLP
Chromosome	3D 6A 6D
Chromosome Arm	3DL 6DS
Map	[ Hide all but 1 of 6 ] Ta-Physical-Gill-3ABD 82 Ta-Physical-Gill-3D 2.94 Ta-Physical-Gill-6ABD -86 Ta-Physical-Gill-6D -3.05 Tm-Dubcovsky2-6A -27.1 Wheat-Composite2004-6A 34
	[ Show Nearby Loci ]
Breakpoint Interval	3DL-2/0 0/6DS-1 3L-0.63-1.00 6S-0.72-1.00
Map Data	T. monococcum, DV92 x G3116 Wheat, Composite, 2004 Wheat, Physical
Species	Triticum aestivum
Probe	pTtksuG48
Reference	Boyko EV et al. (1999) A high-density genetic linkage map of Aegilops tauschii, the D-genome progenitor of bread wheat. Theoretical and Applied Genetics 99:16-26.
Possible Orthologs	G048a [ Show all 13 ]
Probe for Locus	pTtksuG48
Locus	XksuG48-6B [ Show all 14 ]
Synonym	Other name DG G48 Ma Z-Q et al. (1993) RFLP markers linked to two Hessian fly-resistance genes in wheat (Triticum aestivum L.) from Triticum tauschii (coss.) Schmal. Theoretical and Applied Genetics 85:750-754.
Reference	Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type	Genomic STS
PCR primers	R:CGGTAGGGCTCGTGCTCACC L:AGGGAGGCTCGCTGGTTTTT
Polymorphism	KSUG48 EcoRV
Linkage Group	6D, 3D (2)
Insert Enzyme	PstI
Source Species	Triticum tauschii
Insert Size	1.6