Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: XksuH11-6A

[Submit comment/correction]

Locus	XksuH11-6A
Type	RFLP
Chromosome	6A
Chromosome Arm	6AS
Species	Triticum turgidum
Probe	pTtksuH11 Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Reference	Chen Z et al. (1994) Use of recombinant substitution lines in the construction of RFLP-based genetic maps of chromosomes 6A and 6B of tetraploid wheat (Triticum turgidum L.). Theoretical and Applied Genetics 89:703-712.
Possible Orthologs	H011 [ Show all 6 ]
Probe for Locus	pTtksuH11
Locus	[ Hide all but 1 of 8 ] XksuH11-6A XksuH11a XksuH11d ksuH11 XksuH11-4B H011 RI028P18 XksuH11
Reference	Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type	Genomic STS
PCR primers	R:GTAGCCGCTAATCTCGTCTGT L:CGATCTCATAGCGAATATGT
Linkage Group	6D
Insert Enzyme	PstI
Source Species	Triticum aestivum Triticum tauschii
Insert Size	1.8