Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: XksuH8

[Submit comment/correction]

Locus	XksuH8
Type	RFLP
Chromosome	2D 3D 5D 7D
Chromosome Arm	5DS
Map	Ta-Physical-Gill-5ABD -26
	[ Show Nearby Loci ]
Breakpoint Interval	5S-0.17-0.34
Map Data	Wheat, Physical
Species	Triticum aestivum
Probe	pTtksuH8
Reference	Boyko EV et al. (1999) A high-density genetic linkage map of Aegilops tauschii, the D-genome progenitor of bread wheat. Theoretical and Applied Genetics 99:16-26.
Possible Orthologs	[ Hide all but 1 of 9 ] H008a H008b H008c H008d H008e H008f ksu8-4A ksu8-5A ksu8-7A
Probe for Locus	pTtksuH8
Locus	HD032L20 [ Show all 24 ]
Reference	Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type	Genomic STS
PCR primers	L:GAGACCGTGCATCTTCATGT R:GCATAGGTGTTCCCATCTGA
Insert Enzyme	PstI
Source Species	Triticum aestivum Triticum tauschii