Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: XksuH9

[Submit comment/correction]

Locus	XksuH9
Type	RFLP
Chromosome	2D 7A
Chromosome Arm	2DL
Map	Ta-Physical-Gill-2ABD 95 Ta-Physical-Gill-2D 4.98 Tt-Appels-2D 27.45 Wheat-Composite2004-2D 113 Wheat-Composite2004-7A 77
	[ Show Nearby Loci ]
Breakpoint Interval	2DL-9/0 2L-0.89-1.00
Map Data	T.tauschii, Appels Wheat, Composite, 2004 Wheat, Physical
Species	Triticum aestivum
Probe	pTtksuH9
Reference	Boyko EV et al. (1999) A high-density genetic linkage map of Aegilops tauschii, the D-genome progenitor of bread wheat. Theoretical and Applied Genetics 99:16-26.
Possible Orthologs	[ Hide all but 1 of 20 ] H009a H009b H009c H009d XksuH9-1A XksuH9-2 XksuH9-2A XksuH9-2D XksuH9-4A XksuH9-5A XksuH9-5B XksuH9-7A XksuH9.2 XksuH9a XksuH9d ksuH9 ksuH9-5B ksuH9-1A ksuH9-2D ksuH9-7A
Probe for Locus	pTtksuH9
Locus	XksuH9 [ Show all 27 ]
Reference	Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type	Genomic STS
PCR primers	R:GTGTATCACAAGCTTGCTGT L:ATTGACCATTGCCCGGAGAA
Specificity	Primer specificity verified, maps on chromosome 2DL.
Polymorphism	KSUH9 HindIII
Linkage Group	2D, 1D (4)
Insert Enzyme	PstI
Source Species	Triticum aestivum Triticum tauschii
Insert Size	1.5