Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: XksuH9-7A

[Submit comment/correction]

Locus	XksuH9-7A
Type	RFLP
Chromosome	7A
Chromosome Arm	7AL
Map	Ta-Courtot/CS-GPW-7A 267.5 [ Show all 8 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 8 ] T. monococcum, DV92 x G3116 Wheat, Courtot x Chinese Spring, GPW Wheat, Synthetic x Opata  [ GBrowser ] Wheat, Synthetic x Opata, BARC Wheat, Synthetic x Opata, gbx RFLP Wheat, Synthetic x Opata, GPW Wheat, Synthetic x Opata, SSR Wheat, Synthetic x Opata, SSR 2
Probe	pTtksuH9
Image	KSUH9 SO autoradiogram
Possible Orthologs	H009a [ Show all 20 ]
Probe for Locus	pTtksuH9
Locus	XksuH9 [ Show all 27 ]
Reference	Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type	Genomic STS
PCR primers	R:GTGTATCACAAGCTTGCTGT L:ATTGACCATTGCCCGGAGAA
Specificity	Primer specificity verified, maps on chromosome 2DL.
Polymorphism	KSUH9 HindIII
Linkage Group	2D, 1D (4)
Insert Enzyme	PstI
Source Species	Triticum aestivum Triticum tauschii
Insert Size	1.5