Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xmwg60

[Submit comment/correction]

Locus	Xmwg60
Type	RFLP
Chromosome	1A
Chromosome Arm	1AS
Map	1AS, T.m. G1777 x G2528 -34.2 [ Show all 8 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 8 ] 1AS, T.m. G1777 x G2528 1AS, T.m. G3116 x DV92 1BS, CS x CNN T. monococcum, DV92 x G3116 T. monococcum, G1777 x G2528 Triticum, CS-G1777 DS1A^m^(1A) RSL Wheat, Composite, 2004 Wheat, CS x CS-CNN DS1A
Probe	MWG60
Remark	In the population 'T. monococcum, DV92 x G3116,' this locus and Xmwg2048 were mapped with identical restriction fragments, so the corresponding clones are assumed to be homologous.
Possible Orthologs	mwg060 [ Show all 7 ]
Probe for Locus	MWG60
Locus	Xmwg060 [ Show all 11 ]
General Remarks	single - low copy probe
Type	Genomic PCR STS
PCR primers	R:CTGGATAGAGAAGCCATGGA L:CAACGATACAACAGGCTCAA
Amplification Conditions	Anneal at 45oC.
Insert Enzyme	PstI
Source Species	Hordeum vulgare
Insert Size	1.3