Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xmwg835-1A.2

[Submit comment/correction]

Locus	Xmwg835-1A.2
Type	RFLP
Map	Tm-Dubcovsky2-1A -55.7
	[ Show Nearby Loci ]
Map Data	T. monococcum, DV92 x G3116
Probe	MWG835
Remark	In the population 'T. monococcum, DV92 x G3116,' this locus and Xmwg920-1A.2 were mapped with identical restriction fragments, so the corresponding clones are assumed to be homologous. Segregation data are listed under Xmwg920-1A.2.
Possible Orthologs	[ Hide all but 1 of 6 ] MWG835 MWG835A MWG835B Xmwg835-1A.1 Xmwg835-2A Xmwg835-5A
Probe for Locus	MWG835
Locus	MWG835 [ Show all 7 ]
Reference	Marcel TC et al. (2007) A high-density consensus map of barley to compare the distribution of QTLs for partial resistance to Puccinia hordei and of defence gene homologues. Theoretical and Applied Genetics 114:487-500.
Type	Genomic STS
STS primers	5' TTCCCTATTCAAGCCATCAGCAAA 5' GTAACCCATAGATAGCATCTTGTG
STS size	565
Amplification Conditions	5 min at 94 deg C; 35 cycles with 30 sec at 94 deg C, 30 sec at 65 deg C, and 1 min at 72 deg C; and a final extension step of 7 min at 72 deg C
Sequence	AJ234580 MWG835-5
Insert Enzyme	PstI
Source Species	Hordeum vulgare