Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xmwg912-1A

[Submit comment/correction]

Locus	Xmwg912-1A
Type	RFLP
Chromosome	1A
Chromosome Arm	1AL
Map	Ta-Synthetic/Opata-1A 155.6 [ Show all 7 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 7 ] Wheat, Synthetic x Opata  [ GBrowser ] Wheat, Synthetic x Opata, BARC Wheat, Synthetic x Opata, DR Genes Wheat, Synthetic x Opata, gbx RFLP Wheat, Synthetic x Opata, GPW Wheat, Synthetic x Opata, SSR Wheat, Synthetic x Opata, SSR 2
Probe	MWG912
Possible Orthologs	MWG912 [ Show all 10 ]
Probe for Locus	MWG912
Locus	MWG912 [ Show all 11 ]
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	Genomic STS
STS primers	5' CACAACCATACAAGCAGGCG 5' TGGCAGATTTGATCGACTCC
STS size	400
Amplification Conditions	STS annealing temperature 52-55 oC
Sequence	AJ234642 MWG912 MWG912-5
Insert Enzyme	PstI
Source Species	Hordeum vulgare