Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xmwg916-6D

[Submit comment/correction]

Locus	Xmwg916-6D
Type	RFLP
Chromosome	6D
Chromosome Arm	6DS
Map	Ta-Synthetic/Opata-6D -28.3 Ta-Synthetic/Opata-BARC-6D 42.3 Ta-Synthetic/Opata-GPW-6D 54.7
	[ Show Nearby Loci ]
Map Data	Wheat, Synthetic x Opata  [ GBrowser ] Wheat, Synthetic x Opata, BARC Wheat, Synthetic x Opata, GPW
Probe	MWG916
Possible Orthologs	[ Hide all but 1 of 6 ] MWG916 Xmwg916 Xmwg916-6A Xmwg916-6R mwg916 mwg916-6D
Probe for Locus	MWG916
Locus	MWG916 [ Show all 7 ]
Synonym	Synonym HAR35_35585
Reference	Abu Qamar M et al. (2008) A region of barley chromosome 6H harbors multiple major genes associated with net type net blotch resistance. Theoretical and Applied Genetics 117:1261-1270. Kunzel G et al. (2000) Cytologically integrated physical restriction fragment length polymorphism maps for the barley genome based on translocation breakpoints Genetics 154:397-412.
General Remarks	Restriction enzyme informative in CAP analysis is HaeIII
Type	Genomic STS
STS primers	5' GCGGACCAGATCAATATCGA 5' CGACGTAGGGAAACACGCAT
STS size	196
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234646 AJ234645 MWG916-5 MWG916-3
Insert Enzyme	PstI
Source Species	Hordeum vulgare