Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: Xwmc469

[Submit comment/correction]

Locus	Xwmc469
Type	Microsatellite
Map	Ta-NxW-1A 69.7
	[ Show Nearby Loci ]
Map Data	Wheat, Nanda2419 x Wangshuibai
Probe	WMC469
Possible Orthologs	Xwmc469-1A Xwmc469-6D wmc469 wmc469-1A wmc469-6D
Probe for Locus	WMC469
Locus	[ Hide all but 1 of 6 ] Xwmc469 Xwmc469-1A Xwmc469-6D wmc469 wmc469-1A wmc469-6D
Reference	Somers DJ and Isaac P (2004) SSRs from the Wheat Microsatellite Consortium.
General Remarks	Wheat Microsatellite Consortium Project 1, Plate reference 21h12 Donor: Dupont Location from nullisomic/tetrasomic (Daryl Somers, AgCanada, Feb 2001) : 150 bases located on 1A Trimmed to insert at both ends. (CT)13 93 to 118, (CT)27 120 to 173.
Type	PCR SSR
PCR primers	Forward aggtggctgccaacg at 45 length 15 bases, Tm 60 Reverse caattttatcagatgcccga at 173 length 20 bases, Tm 60
SSR size	148 bases expected, Chinese Spring
Amplification Conditions	51C anneal, polymorphic on acrylamide (polymorphism 120-148 and many other bands).
Sequence	WMC469
Source Species	Triticum aestivum