Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: cMWG669

[Submit comment/correction]

Locus	cMWG669
Type	RFLP
Chromosome	6H
Chromosome Arm	6HL
Map	Barley-consensus-2003-6H 83 [ Show all 10 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QTil.TyVo-6H
Map Data	[ Hide all but 1 of 10 ] Barley consensus Barley consensus 2 Barley consensus 2003 Barley, BinMap 2005 Barley, Consensus 2006, Marcel Barley, GxH Barley, Integrated, Marcel 2009 Barley, IxF Barley, VGxTP Barley, VxHs
Probe	cMWG669
Data Source	Kleinhofs, Andris Langridge, Peter J.
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	cMWG669-6H [ Show all 8 ]
Probe	cMWG669
Locus	Xcmwg669-6 [ Show all 15 ]
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	cDNA STS
STS primers	5' CTTGCTCGGTTGACTGTGTT 5' GCTGCGGCACCTGAGTTAAA
STS size	499
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234413 AJ234412 cMWG669 CMWG669-5 CMWG669-3
Linkage Group	6H
DNA Library	cMWG
Source Species	Hordeum vulgare
Source Tissue	Leaf
Insert Size	2