Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: cMWG703

[Submit comment/correction]

Locus	cMWG703
Type	RFLP
Chromosome	7H
Chromosome Arm	7HS
Map	Barley-Consensus-7H -55.9 [ Show all 6 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 6 ] Barley consensus Barley consensus 2 Barley, BinMap 2005 Barley, Consensus 2006, Marcel Barley, Integrated, Marcel 2009 Barley, IxF
Probe	cMWG703
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	cMWG703-7H
Probe	cMWG703
Locus	cMWG703 cMWG703-7H
Synonym	Synonym HAR35_14494 HAR35_14496 HAR35_19286
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	cDNA STS
STS primers	5' CATCATAGCCGTCTGTATGGG 5' AATGTCCGCTTTGGAGTCAGG
STS size	ca. 1130
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234429 CMWG703-5 CMWG703-3
Linkage Group	7H
DNA Library	cMWG
Source Species	Hordeum vulgare
Source Tissue	Leaf
Insert Size	1.2