Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: cMWG704

[Submit comment/correction]

Locus	cMWG704
Type	RFLP STS
Chromosome	7H
Chromosome Arm	7HL
Map	Barley-Consensus-7H 6.5 [ Show all 8 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 8 ] Barley consensus Barley consensus 2 Barley, AxK Barley, BinMap 2005 Barley, Consensus 2006, Marcel Barley, HN x H602, Sato2009 Barley, Integrated, Marcel 2009 Barley, IxF
Species	Hordeum vulgare Hordeum vulgare subsp. spontaneum
Probe	cMWG704
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	cMWG704-7H Xcmwg704
Probe	cMWG704
Locus	cMWG704 HI072G1 HD072G1 Xcmwg704 cMWG704-7H
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	cDNA STS
STS primers	5' AATGTCCGCTTTGGAGTCAGG 5' ACCAGACACCACAGAGGCACA
STS size	236
Amplification Conditions	STS annealing temperature 62-65 oC
Sequence	AJ234430 cMWG704 CMWG704-5
DNA Library	cMWG
Source Species	Hordeum vulgare
Source Tissue	Leaf