Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: cMWG706A

[Submit comment/correction]

Locus	cMWG706A
Type	RFLP
Synonym	Synonym cMWG706
Chromosome	1H
Map	Barley-Consensus2-1H 114.7 [ Show all 19 ]
	[ Show Nearby Loci ]
Map Data	Barley consensus 2 [ Show all 19 ]
Species	Hordeum vulgare
Probe	cMWG706
Reference	Close TJ et al. (2009) Development and implementation of high-throughput SNP genotyping in barley. BMC Genomics 10:582. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source	Blake, Tom 05.04.19 Close, Timothy J.
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Oregon Wolfe Barleys,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Oregon Wolfe Dom x Rec; Igri x Franka Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs	[ Hide all but 1 of 6 ] cMWG706 cMWG706a-1H Xcmwg706 Xcmwg706-1A Xcmwg706-1D cmwg706
Probe for Locus	cMWG706
Locus	cMWG706A [ Show all 7 ]
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	cDNA STS
STS primers	5' GGGCAAGACTGTGCTGGAGC 5' CCAGTGGATTTGTACTGCAC
STS size	ca. 1200
Amplification Conditions	STS annealing temperature 58-60 oC
Sequence	AJ234432 CMWG706-5
Linkage Group	1H Barley 1 (7H) Barley 5 (1H)
DNA Library	cMWG
Source Species	Hordeum vulgare
Source Tissue	Leaf
Insert Size	0.75 0.8