Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: cMWG733

[Submit comment/correction]

Locus	cMWG733
Type	RFLP
Synonym	Synonym cMWG733A
Chromosome	1H
Chromosome Arm	1HL
Map	Barley-Consensus-1H 78.8 [ Show all 14 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 14 ] Barley consensus Barley consensus 2 Barley genes Barley, Consensus 2006, DArT Barley, Consensus 2006, Marcel Barley, Consensus 2007, SSR Barley, Consensus 2023, FHB Barley, Igri x Franka, SSR Barley, Integrated, Marcel 2009 Barley, IxF Barley, Steptoe x Morex, SSAP Barley, SxM Barley, SxM basemap Barley, SxM, Feed QTLs
Species	Hordeum vulgare
Probe	cMWG733
Reference	Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source	Blake, Tom 05.04.19
Remark	Number of populations contributing to the placement of cMWG733 in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex,Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex; Igri x Franka Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs	cMWG733-1H [ Show all 14 ]
Probe	cMWG733
Locus	cMWG733 [ Show all 15 ]
Synonym	Synonym HAR35_20177
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	cDNA STS
STS primers	5' GCGGTGGTACAAAGACAAAGTCCA 5' CTGCATACATGTTCGTCGATACTAAG
STS size	182
Amplification Conditions	STS annealing temperature 62-65 oC
Sequence	AJ234443 AJ234442 cMWG733 CMWG733-5 CMWG733-3
Linkage Group	1H
DNA Library	cMWG
Source Species	Hordeum vulgare
Source Tissue	Leaf
Insert Size	1