Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: cMWG781

[Submit comment/correction]

Locus	cMWG781
Type	RFLP
Synonym	Synonym POPA2_0405
Chromosome	5H
Map	Barley-Consensus2-5H 130.2 [ Show all 6 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 6 ] Barley consensus 2 Barley, BinMap 2005 Barley, Consensus 2006, Marcel Barley, Consensus 2023, FHB Barley, Integrated, Marcel 2009 Barley, IxF
Probe	cMWG781
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Igri x Franka Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Igri x Franka
Possible Orthologs	cMWG781-5H
Probe	cMWG781
Locus	cMWG781 cMWG781-5H
Synonym	Synonym HAR35_14983 HAR35_14985 HAR35_14986
Reference	Graner A et al. (1991) Construction of an RFLP map of barley Theoretical and Applied Genetics 83:250-256.
Type	cDNA STS
STS primers	5' ATTCCGGGTCTTCATTCAGG 5' CTTACGCAGCAATCTTGTCG
STS size	ca. 400
Amplification Conditions	STS annealing temperature 55-58 oC
Sequence	AJ234452 CMWG781-3
DNA Library	cMWG
Source Species	Hordeum vulgare
Source Tissue	Leaf