Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: k02154

[Submit comment/correction]

Locus	k02154
Type	CAPS
Chromosome	6H
Map	Hv-HNxH602-6H 158.2
	[ Show Nearby Loci ]
Map Data	Barley, HN x H602, Sato2009
Species	Hordeum vulgare Hordeum vulgare subsp. spontaneum
Probe	bags15d14
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark	[ Hide all but 1 of 11 ] Restriction enzyme used for CAPS analysis = FokI SNP = N/A SNP structure (UNICODE) = CTATTTTTTAN/AAGGATGGGAC Parent 1 SNP sequence = CTATTTTTTANAGGATGGGAC Parent 2 SNP sequence = CTATTTTTTAAAGGATGGGAC Recognized sequence for CAPs locus = GGATGNNNNNNNNN SNP = C/T SNP structure (UNICODE) = CTTTGTCATCYGTATTTCTTA Parent 1 SNP sequence = CTTTGTCATCCGTATTTCTTA Parent 2 SNP sequence = CTTTGTCATCTGTATTTCTTA Recognized sequence for CAPs locus = NNNNNNNNNNNNNCATCC
Probe for Locus	bags15d14
Locus	k02154
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks	Best BLAST Hit = amino acid transporter family protein [Arabidopsis thaliana] gb AAK64155.1 unknown protein [Arabidopsis thaliana]
Type	PCR
PCR primers	Left 5' - CACAGTTGCGCTTCTGGTTA Right 5' - GTTTTGCTGATTCGGTTGGT
Sequence	AV920696
PCR size	392