Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: k07791

[Submit comment/correction]

Locus	k07791
Type	CAPS
Chromosome	4H
Map	Hv-HNxH602-4H 87.6
	[ Show Nearby Loci ]
Map Data	Barley, HN x H602, Sato2009
Species	Hordeum vulgare Hordeum vulgare subsp. spontaneum
Probe	BaGS15L23
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark	[ Hide all but 1 of 10 ] Restriction enzyme used for CAPS analysis = TaqI SNP = C/T SNP structure (UNICODE) = CTGCAC-ACTYGAYTGCTTRA Parent 1 SNP sequence = CTGCAC-ACTCGATTGCTTAA Parent 2 SNP sequence = CTGCACGACTTGACTGCTTGA Recognized sequence for CAPs locus = TCGA SNP = G/A SNP structure (UNICODE) = TACAGTTGTCRAACAATTACA Parent 1 SNP sequence = TACAGTTGTCGAACAATTACA Parent 2 SNP sequence = TACAGTTGTCAAACAATTACA
Probe for Locus	BaGS15L23
Locus	k07791
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks	Best BLAST Hit = 40S ribosomal protein S27 (Manganese efficiency related protein 1) emb CAA59732.2 putative zinc finger protein [Hordeum vulgare subsp. vulg
Type	PCR
PCR primers	Left 5' - AAAGCCAAAGAAGAATCGCA Right 5' - TGCTACGTGTTGATGGTGGT
Sequence	AV920829
PCR size	350