Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: k07862

[Submit comment/correction]

Locus	k07862
Type	CAPS
Chromosome	1H
Map	Hv-HNxH602-1H 169.5
	[ Show Nearby Loci ]
Map Data	Barley, HN x H602, Sato2009
Species	Hordeum vulgare Hordeum vulgare subsp. spontaneum
Probe	BaGS37L06
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
Remark	[ Hide all but 1 of 12 ] Restriction enzyme used for CAPS analysis = FokI SNP = G/A SNP structure (UNICODE) = TCTCGGCCTCRGTGAACTCCA Parent 1 SNP sequence = TCTCGGCCTCGGTGAACTCCA Parent 2 SNP sequence = TCTCGGCCTCAGTGAACTCCA Recognized sequence for CAPs locus = NNNNNNNNNNNNNCATCC SNP structure (UNICODE) = AAAGCACAATRCCACATAAAT Parent 1 SNP sequence = AAAGCACAATGCCACATAAAT Parent 2 SNP sequence = AAAGCACAATACCACATAAAT SNP structure (UNICODE) = CATTCATGTTRCTCTCGGCCT Parent 1 SNP sequence = CATTCATGTTGCTCTCGGCCT Parent 2 SNP sequence = CATTCATGTTACTCTCGGCCT
Probe for Locus	BaGS37L06
Locus	k07862
Reference	Sato K et al. (2009) A high-density transcript linkage map of barley derived from a single population. Heredity 103:110-117.
General Remarks	Best BLAST Hit = Tubulin beta-2 chain (Beta-2 tubulin) pir S14702 tubulin beta-2 chain - maize
Type	PCR
PCR primers	Left 5' - ATCCACAACCGACTCTTTGG Right 5' - ACCACGCATTTGGAACAAGT
Sequence	BJ468221
PCR size	377