Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ksuD17

[Submit comment/correction]

Locus	ksuD17
Type	RFLP
Synonym	Synonym pTtksuD17
Chromosome	6H
Chromosome Arm	6HL
Map	Barley-Consensus-6H 2.6 [ Show all 16 ]
	[ Show Nearby Loci ]
QTL with Locus Marker	QDp.StMo-6H QLg.StMo-6H QNb.StMo-6H.2 QSss.StMo-6H QYld.StMo-6H
Map Data	[ Hide all but 1 of 16 ] Barley consensus Barley consensus 2 Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, BinMap 2005 Barley, Consensus 2005, SNP Barley, Consensus 2006, DArT Barley, Consensus 2006, Marcel Barley, HxT Barley, Integrated, Marcel 2009 Barley, Pilot OPA1, Consensus Barley, Steptoe x Morex, SNP Barley, Steptoe x Morex, SSAP Barley, SxM Barley, SxM basemap Barley, SxM, Feed QTLs
Probe	pTtksuD17
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rodriguez M et al. (2006) Integration of retrotransposons-based markers in a linkage map of barley. Molecular Breeding 17:173-184. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Blake, Tom 05.04.19 Close, Timothy J.
Remark	Number of populations contributing to the placement of ksuD17 in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex
Possible Orthologs	D017 [ Show all 6 ]
Probe for Locus	pTtksuD17
Locus	ksuD17 [ Show all 9 ]
Type	Genomic STS
PCR primers	R:CTGCTTGGGTCATCATGCAA L:CAAACAAGCAGCCAGGTAG
Specificity	Primer specificity verified, maps on chromosome 6DL.
Polymorphism	KSUD17 HindIII
Linkage Group	6DL
Insert Enzyme	PstI
Source Species	Triticum aestivum Triticum tauschii
Insert Size	1.2