Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ksuD22

[Submit comment/correction]

Locus	ksuD22
Type	RFLP
Synonym	Synonym pTtksuD22
Chromosome	2H
Chromosome Arm	2HL
Map	Barley-consensus-2003-2H 65.6 [ Show all 17 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 19 ] Barley consensus Barley consensus 2 Barley consensus 2003 Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, BinMap 2005 Barley, Consensus 2005, SNP Barley, Consensus 2006, DArT Barley, Consensus 2006, Marcel Barley, Consensus 2007, SSR Barley, CxS Barley, GxH Barley, Integrated, Marcel 2009 Barley, OPA 2009, Consensus Barley, Pilot OPA1, Consensus Barley, Steptoe x Morex, SNP Barley, Steptoe x Morex, SSR Barley, SxM Barley, SxM, Feed QTLs
Species	Hordeum vulgare
Probe	pTtksuD22
Reference	Close TJ et al. (2009) Development and implementation of high-throughput SNP genotyping in barley. BMC Genomics 10:582. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Li JZ et al. (2003) Development and genetic mapping of 127 new microsatellite markers in barley Theoretical and Applied Genetics 107:1021-1027.
Data Source	Close, Timothy J. Langridge, Peter J.
Remark	Number of populations contributing to the placement of ksuD22 in the Barley, Consensus 2006 DArT maps = 1 Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Steptoe x Morex Loci in 'Barley, Consensus 2006, Marcel' mapped in population(s) : Steptoe x Morex Locus in 'Barley, Consensus 2007, SSR' was a BIN marker in 'Barley, Consensus 2006, Marcel'
Possible Orthologs	D022 [ Show all 7 ]
Probe for Locus	pTtksuD22
Locus	XksuD22 [ Show all 11 ]
Reference	Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type	Genomic STS
PCR primers	R:AGCAGGAACAAACACATCAT L:TCGCCGTCACCCAACTCACC
Polymorphism	KSUD22 XbaI KSUD22 EcoRI KSUD22 EcoRV KSUD22 HindIII KSUD22 DraI
Linkage Group	2D / 2DL 2
Insert Enzyme	PstI
Source Species	Triticum aestivum Triticum tauschii
Insert Size	1.5