Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ksuF41

[Submit comment/correction]

Locus	ksuF41
Type	RFLP
Chromosome	2H
Chromosome Arm	2HL
Map	[ Hide all but 1 of 7 ] Barley-consensus-2003-2H 137.4 Barley-Consensus-2H 59.8 Hordeum-Bins-2H 162 Hordeum-Consensus2006-DArT-2H 149.4 Hordeum-CxH-2H 192.17 Hordeum-CxS-2H 187.84 Hordeum-GxH-2H 235.51
	[ Show Nearby Loci ]
Map Data	Barley consensus [ Show all 7 ]
Probe	pTtksuF41
Reference	Wenzl P et al. (2006) A high-density consensus map of barley linking DArT markers to SSR, RFLP and STS loci and agricultural traits BMC Genomics 7:206.
Data Source	Kleinhofs, Andris Langridge, Peter J.
Remark	Number of populations contributing to the placement of ksuF41 in the Barley, Consensus 2006 DArT maps = 1 This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin
Possible Orthologs	F041 [ Show all 11 ]
Probe for Locus	pTtksuF41
Locus	XksuF41-2 [ Show all 13 ]
Type	Genomic STS
PCR primers	R:TCTCCTAGCATAGCAGATGG L:AGTCGTGTCGACTCGTCCAA
Polymorphism	KSUF41 EcoRV [ Show all 6 ]
Linkage Group	2D / 2D
Insert Enzyme	PstI
Source Species	Triticum tauschii
Insert Size	0.9