Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: ksuG59

[Submit comment/correction]

Locus	ksuG59
Type	RFLP
Synonym	Synonym pTtksuG59
Chromosome	3H
Chromosome Arm	3HL
Map	[ Hide all but 1 of 8 ] Barley-Consensus-3H 18.7 CIMMYT-integrated-3B 55.79 Hordeum-Bins-3H 91 Hordeum-Consensus2005-SNP-3H 69.97 Hordeum-QTLConsensus-Abiotic-3H 69.97 Hordeum-QTLConsensus-Agronomic-3H 69.97 Hordeum-StMo-SNP-3H 71.06 Physical-3B 58.56
	[ Show Nearby Loci ]
Map Data	3B Physical [ Show all 8 ]
Probe	pTtksuG59
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Kleinhofs, Andris
Remark	This marker is a Binlocus in the Hordeum-Bins maps, i.e. a marker mapped in other crosses and located to the Steptoe x Morex bin
Possible Orthologs	G059 XksuG59 XksuG59-3 XksuG59-3D
Probe for Locus	pTtksuG59
Locus	ksuG59 [ Show all 9 ]
Reference	Gill KS et al. (1991) A genetic linkage map of Triticum tauschii (DD) and its relationship to the D genome of bread wheat (AABBDD). Genome 34:362-374.
Type	Genomic STS
PCR primers	R:TGCGTATGTAATGTAGGACT L:GGAAAATATAAAAATCAGAT
Polymorphism	KSUG59 EcoRI
Linkage Group	3D
Insert Enzyme	PstI
Source Species	Triticum aestivum Triticum tauschii
Insert Size	0.9