Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: scind02587

[Submit comment/correction]

Locus	scind02587
Type	Indel
Synonym	Other name Best1800 Synonym ABC02587_L01R01
Chromosome	5H
Map	Hordeum-Consensus2005-SNP-5H 50.962 [ Show all 6 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 6 ] Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, Consensus 2005, SNP Barley, Integrated, Marcel 2009 Barley, Nure x Tremois Barley, OWB, SNP
Probe	ABC02587_L01R01
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Russell, Joanne
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Nure x Tremois
Probe for Locus	ABC02587_L01R01
Locus	scind02587
Data at Germinate	ABC02587
Data at PLEXdb	Barley1_02587
General Remarks	Estimated product size = 199 BarleySNP type = EST Indel Technology platform used = Radioisotope Labelled PCR Separation Affymetrix contig name = abc02587
Type	STS
PCR primers	5' GGTGACCCAGCCAAATTTTA 5' GCAGCTGCTAGTTGGTTCATC
Sequence	Barley1_02587
Source Species	Hordeum vulgare