Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: scsnp00177

[Submit comment/correction]

Locus	scsnp00177
Type	SNP
Synonym	Other name SNP2719 Synonym ABC00177_L02R02
Chromosome	5H
Map	[ Hide all but 1 of 8 ] Hordeum-Consensus2005-SNP-5H 124.383 Hordeum-OWB-2005-5H 127.7 Hordeum-OWB-OPA2008-5H 140.729 Hordeum-OWB-SNP-5H 84.66 Hordeum-QTLConsensus-Abiotic-5H 124.38 Hordeum-QTLConsensus-Agronomic-5H 124.38 Hv-Integrated2009-5H 108.2 Hv-Nure/Tremois-5H 109.3
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus [ Show all 8 ]
Species	Hordeum vulgare
Probe	ABC00177_L02R02
Reference	Szucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Russell, Joanne
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys,Nure x Tremois
Probe for Locus	ABC00177_L02R02
Locus	scsnp00177
Data at Germinate	ABC00177
Data at PLEXdb	Barley1_00177
General Remarks	Estimated product size = unknown BarleySNP type = SNP From EST Technology platform used = PyrosequencingTM Technology Affymetrix contig name = abc00177
Type	STS
PCR primers	5' AATCTGCTCATCCCATCTGC 5' GTTCAGGCAATGCAGCATAA
Sequence	Barley1_00177
Source Species	Hordeum vulgare