Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: scsnp00460

[Submit comment/correction]

Locus	scsnp00460
Type	SNP
Synonym	Other name SNP1239(2) Synonym ABC00460_L01R01
Chromosome	7H
Map	Hordeum-Consensus2005-SNP-7H 74.96 [ Show all 7 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 7 ] Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, Consensus 2005, SNP Barley, Integrated, Marcel 2009 Barley, OWB, 2005 Barley, OWB, OPA2008 Barley, OWB, SNP
Species	Hordeum vulgare
Probe	ABC00460_L01R01
Reference	Szucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Russell, Joanne
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys
Probe for Locus	ABC00460_L01R01
Locus	scsnp00460
Data at Germinate	ABC00460
Data at PLEXdb	Barley1_00460
General Remarks	Estimated product size = 98 BarleySNP type = SNP From EST Technology platform used = PyrosequencingTM Technology Affymetrix contig name = abc00460
Type	STS
PCR primers	5' TTGAAGACATCCTCCGTGCT 5' CCCGAATGTAGTCCCAGACA
Sequence	Barley1_00460
Source Species	Hordeum vulgare