Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: scsnp23255

[Submit comment/correction]

Locus	scsnp23255
Type	SNP
Synonym	Other name SNP3167 Synonym ABC23255_L01R01
Chromosome	3H
Map	Hordeum-Consensus2005-SNP-3H 118.025 [ Show all 6 ]
	[ Show Nearby Loci ]
Map Data	[ Hide all but 1 of 6 ] Barley, Abiotic QTL Consensus Barley, Agronomic QTL Consensus Barley, Consensus 2005, SNP Barley, Integrated, Marcel 2009 Barley, OWB, 2005 Barley, OWB, SNP
Species	Hordeum vulgare
Probe	ABC23255_L01R01
Reference	Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527.
Data Source	Russell, Joanne
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys
Probe for Locus	ABC23255_L01R01
Locus	scsnp23255
Data at Germinate	ABC23255
General Remarks	Estimated product size = 182 BarleySNP type = SNP From EST Technology platform used = PyrosequencingTM Technology Affymetrix contig name = abc23255
Type	STS
PCR primers	5' CTCAGTGCCAGCACATTTTC 5' CTGGCAAAAGGAGGAAAGAA
Source Species	Hordeum vulgare