Query (optional)   in Class  All Allele Author Colleague Collection Assembly Gene Gene Class Gene Product Germplasm Image Journal Keyword Library Locus Map Map Data Marker Pathology Polymorphism Probe Protein QTL Rearrangement Reference Sequence Species Trait Trait Study Two Point Data  

---

GrainGenes Marker Report: scssr03381

[Submit comment/correction]

Locus	scssr03381
Type	Microsatellite SNP
Synonym	Other name Ctig1624 Synonym ABC03381_L01R01
Chromosome	2H
Map	[ Hide all but 1 of 10 ] Barley, B73xCPI-2H 64.9 Barley-ConsensusFHB-2H 70.29 Hordeum-Consensus2005-SNP-2H 55.303 Hordeum-Consensus2007-SSR-2H 63.61 Hordeum-OWB-2005-2H 56.4 Hordeum-OWB-OPA2008-2H 66.181 Hordeum-OWB-SNP-2H 61.6 Hordeum-QTLConsensus-Abiotic-2H 55.3 Hordeum-QTLConsensus-Agronomic-2H 55.3 Hv-Integrated2009-2H 60.3
	[ Show Nearby Loci ]
Map Data	Barley, Abiotic QTL Consensus [ Show all 10 ]
Species	Hordeum vulgare
Probe	ABC03381_L01R01 scssr03381
Reference	Szucs P et al. (2009) An Integrated Resource for Barley Linkage Map and Malting Quality QTL Alignment The Plant Genome 2:134-140. Varshney RK et al. (2007) A high density barley microsatellite consensus map with 775 SSR loci. Theoretical and Applied Genetics 114:1091. Rostoks N et al. (2005) Genome-wide SNP discovery and linkage analysis in barley based on genes responsive to abiotic stress. Molecular Genetics and Genomics 274:515-527. Ramsay L et al. (2004) Variation shown by molecular markers in barley: genomic and genetic contraints Aspects of Applied Biology 72:146-154.
Data Source	Russell, Joanne
Remark	Bin on the 'Barley, Integrated, Marcel 2009' Map Set : 'chromosome_kleinhofs & graner BIN nb.subBIN nb' Mapping population(s) used for locus placement on the 'Barley, Integrated, Marcel 2009' Map Set = Oregon Wolfe Barleys Locus in 'Barley, Consensus 2007, SSR' mapped in population(s) : OWBrecessive x OWBdominant Insert contains repeat (GT)7 Developing laboratory = SCRI (R. Waugh)
Probe for Locus	ABC03381_L01R01
Locus	scssr03381
Data at Germinate	ABC03381
Data at PLEXdb	Barley1_03381
General Remarks	Estimated product size = 162 BarleySNP type = Contig Indel Technology platform used = Radioisotope Labelled PCR Separation Affymetrix contig name = abc03381
PCR primers	5' CAGGGACGTACAATATTACCG 5' AATAAGCAGGGTACCTTTTGG
Sequence	Barley1_03381
Source Species	Hordeum vulgare